SMIM14 (Small Integral Membrane Protein 14) is a Protein Coding gene. Diseases associated with SMIM14 include Mitochondrial Complex Iii Deficiency and

Figure 1. Schematic of data sources for My Cancer Genome. Curated assertions on the My Cancer Genome website are housed within a Knowledge Management System (KMS) created through a partnership with GenomOncology that serves as a warehouse of biomarker, disease, and drug ontologies; biomarker-driven cancer clinical trials; therapeutic, prognostic, and diagnostic assertions; and unstructured

Detecting Gene Alterations in Cancers Glossary Targeted Therapies Molecular Tumor Board SMIM14 (small integral membrane protein 14) SMIM14 - Small integral membrane protein 14 - Homo sapiens (Human) - SMIM14 gene & protein UniProtKB - D6RGZ0 (D6RGZ0_HUMAN) cell lines with high or low copy number of SMIM14 gene relative to other cell lines from the COSMIC Cell Line Gene CNV Profiles dataset. CTD Gene-Chemical Interactions chemicals interacting with SMIM14 gene/protein from the curated CTD Gene-Chemical Interactions dataset. smim14 ID ZDB-GENE-040426-22 Name small integral membrane protein 14 Symbol smim14 Nomenclature History Previous Names. zgc:77713; Type protein_coding_gene Location Chr: 1 Mapping Details/Browsers Description Predicted to localize to endoplasmic reticulum. Smim14. Name.

FAM46C. 0. 2. 4.

protein coding gene. IDs. Symbol, synonyms, gene family about SMIM14 and general information of SMIM14 protein, SMIM14 gene, et al. Detailed information about SMIM14 gene function, sequence, synonyms and expression tissues.

Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 12356 SMIM13 HGLibB_45674 GGGAGACACAGGATCCCAAG 12355 SMIM14

by Gene › SMIM14 Antibodies; SMIM14 Antibodies . View more. View less.

Expression of SMIM14 (C4orf34, FLJ13289) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers.

Top 10 preferentially essential genes. Combined RNAi Gene. Variant Classification. Variant Annotation. Variant Type. Annotation Transcript. Protein Change.

Wide variety of Top suppliers High-quality customer support. Gene: SMIM14 Selected probe(set): 227052_at Platform: Affymetrix Human Genome U133 Plus 2.0 Array. Expression of SMIM14 (227052_at) across 6540 perturbations tested by GENEVESTIGATOR: brefeldin A study 1 (0.5ug/ml; HCT 116) / untreated HCT 116 cell sample Cell atlas. Showing subcellular location of SMIM14 (C4orf34, FLJ13289). 55 SMIM14 Silencer Select Pre-designed, Validated, and Custom siRNA in Standard, HPLC, and In-vivo Ready Purities. Cell atlas.
Bodelning värdering lösöre schablon

0. 2. 4. 6. 8.

12.
Medvind attendo stockholm

andningsövning mot stress
transportstyrelsen körkortstillstånd telefonnummer
receptarie uppsala
religion kultur ethik
kurs employer branding

This study aimed to use gene chips to investigate differential gene expression profiles in the occurrence and development of SMIM14, -1.2562, 0.006733.

1110003E01Rik, 1700127H04Rik, 5430439C17Rik, MAd4, MGC:7185. Feature Type. protein coding gene. IDs. Expression of SMIM14 (C4orf34, FLJ13289) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers. Complete information for MOCS3 gene (Protein Coding), Molybdenum Cofactor Synthesis 3, including: function, proteins, disorders, pathways, orthologs, and expression. Complete information for SMIM14 gene (protein-coding), small integral membrane protein 14, including: function, proteins, disorders, pathways, orthologs, and expression.